Skip to main content
Addgene

CL7-LbCas12aD156R
(Plasmid #164659)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164659 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PET
  • Backbone manufacturer
    TriAltus Bioscience
  • Backbone size w/o insert (bp) 6439
  • Total vector size (bp) 10210
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LbCas12a-D156R
  • Alt name
    LbCpf1-D156R
  • Species
    Lachnospiraceae bacterium
  • Insert Size (bp)
    3864
  • Mutation
    changed Aspartic Acid 156 to Arginine
  • Promoter T7
  • Tag / Fusion Protein
    • Thioredoxin, CL7, SUMO (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The vector is derived from TriAltus Bioscience plasmid #21, while the LbCpf1 gene is from Addgene #102566.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CL7-LbCas12aD156R was a gift from Piyush Jain (Addgene plasmid # 164659 ; http://n2t.net/addgene:164659 ; RRID:Addgene_164659)
  • For your References section:

    CRISPR-ENHANCE: An enhanced nucleic acid detection platform using Cas12a. Nguyen LT, Gurijala J, Rananaware SR, Pizzano BLM, Stone BT, Jain PK. Methods. 2021 Feb 9. pii: S1046-2023(21)00025-6. doi: 10.1016/j.ymeth.2021.02.001. 10.1016/j.ymeth.2021.02.001 PubMed 33577982