CL7-LbCas12aD156R
(Plasmid
#164659)
-
PurposeBacterial expression of mutated LbCas12aD156R using CL7/Im7
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164659 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePET
-
Backbone manufacturerTriAltus Bioscience
- Backbone size w/o insert (bp) 6439
- Total vector size (bp) 10210
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLbCas12a-D156R
-
Alt nameLbCpf1-D156R
-
SpeciesLachnospiraceae bacterium
-
Insert Size (bp)3864
-
Mutationchanged Aspartic Acid 156 to Arginine
- Promoter T7
-
Tag
/ Fusion Protein
- Thioredoxin, CL7, SUMO (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe vector is derived from TriAltus Bioscience plasmid #21, while the LbCpf1 gene is from Addgene #102566.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CL7-LbCas12aD156R was a gift from Piyush Jain (Addgene plasmid # 164659 ; http://n2t.net/addgene:164659 ; RRID:Addgene_164659) -
For your References section:
CRISPR-ENHANCE: An enhanced nucleic acid detection platform using Cas12a. Nguyen LT, Gurijala J, Rananaware SR, Pizzano BLM, Stone BT, Jain PK. Methods. 2021 Feb 9. pii: S1046-2023(21)00025-6. doi: 10.1016/j.ymeth.2021.02.001. 10.1016/j.ymeth.2021.02.001 PubMed 33577982