pLentiCRISPRv1.mir451_KO
(Plasmid
#164689)
-
PurposeFor CRISPR knockout of miR-451 by lentiviral delivery of Cas9 and miR-451 gRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164689 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLentiCRISPRv1
-
Backbone manufacturerAddgene
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemiR-451 CRISPR KO gRNA
-
gRNA/shRNA sequenceACTGAGTTTAGTAATGGTAA
-
Entrez GeneMIR451A (a.k.a. MIR451, MIRN451, hsa-mir-451, hsa-mir-451a, mir-451a)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (unknown if destroyed)
- 3′ cloning site BsmBI (unknown if destroyed)
- 5′ sequencing primer CGACTCGGTGCCACTTTTTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPRv1.mir451_KO was a gift from David Bartel (Addgene plasmid # 164689 ; http://n2t.net/addgene:164689 ; RRID:Addgene_164689) -
For your References section:
MicroRNA Clustering Assists Processing of Suboptimal MicroRNA Hairpins through the Action of the ERH Protein. Fang W, Bartel DP. Mol Cell. 2020 Apr 16;78(2):289-302.e6. doi: 10.1016/j.molcel.2020.01.026. 10.1016/j.molcel.2020.01.026 PubMed 32302541