pCB301TOR-CRISPR
(Plasmid #164797)

• Purpose: For gene editing in oomycetes
• Depositing Lab: Miaoying Tian
• Publication: Gumtow et al Mol Plant Microbe Interact. 2018 Mar;31(3):363-373. doi: 10.1094/MPMI-06-17-0131-FI. Epub 2018 Jan 3.

Backbone

• Vector backbone: pCB301
• Total vector size (bp): 13119
• Vector type: Oomycete expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: PsNLS-hSpCas9
• Species: H. sapiens (human); Phytophthora sojae
• Insert Size (bp): -4
• Promoter: HAM34

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: ATGCACAAGCGCAAGCGCGAGGA
• 3′ sequencing primer: TTAGTCGCCTCCCAGCTG AGAC

Gene/Insert 2

• Gene/Insert name: sgRNA expression cassette
• Promoter: RPL41

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: GTTCC GTCATTTCCTCGCAGCAAC
• 3′ sequencing primer: AAGCACAATAGGCCCAGACTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry