Skip to main content

pHR_SFFv_4D5-WT-Highest-CAR_RHL004
(Plasmid #164826)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164826 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHR'SIN
  • Backbone size w/o insert (bp) 9033
  • Total vector size (bp) 10546
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AntiHER2 4D5-WT Chimeric Antigen receptor (CD8alphaTM-41BB-CD3z)
  • Species
    Synthetic
  • Insert Size (bp)
    1509
  • Promoter SFFV

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CTTCTGCTTCCCGAGCTCTA
  • 3′ sequencing primer gaataccagtcaatctttcacaaa
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR_SFFv_4D5-WT-Highest-CAR_RHL004 was a gift from Wendell Lim (Addgene plasmid # 164826 ; http://n2t.net/addgene:164826 ; RRID:Addgene_164826)
  • For your References section:

    T cell circuits that sense antigen density with an ultrasensitive threshold. Hernandez-Lopez RA, Yu W, Cabral KA, Creasey OA, Lopez Pazmino MDP, Tonai Y, De Guzman A, Makela A, Saksela K, Gartner ZJ, Lim WA. Science. 2021 Mar 12;371(6534):1166-1171. doi: 10.1126/science.abc1855. Epub 2021 Feb 25. 10.1126/science.abc1855 PubMed 33632893