pHR_Gal4UAS_4D5-Low_CAR-mCherry_pGK_4D5-Medium_SynNotch_RHL144
(Plasmid
#164828)
-
PurposeLentiviral vector for Gal4 inducible AntiHER2 4D5-Low CAR-mCherry and constitutive expression of antiHER2 4D5-Medium Gal4VP64 Synthetic Notch
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164828 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepHR'SIN
- Backbone size w/o insert (bp) 9197
- Total vector size (bp) 13925
-
Modifications to backbonepGK promoter and inducible Gal4UAS miniCMV promoter
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameAntiHER2 4D5-Low Chimeric Antigen receptor (CD8alphaTM-41BB-CD3z)
-
SpeciesSynthetic
-
Insert Size (bp)1542
- Promoter miniCMV
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer agagctcgtttagtgaaccg
- 3′ sequencing primer CAGCGGGGCTGCTAAAGCGCATGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameAntiHER2 4D5-Medium Gal4VP64 synthetic Notch receptor
-
Insert Size (bp)2445
- Promoter pGK
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCTTCAAAAGCGCACGTCT
- 3′ sequencing primer catagcgtaaaaggagcaaca (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR_Gal4UAS_4D5-Low_CAR-mCherry_pGK_4D5-Medium_SynNotch_RHL144 was a gift from Wendell Lim (Addgene plasmid # 164828 ; http://n2t.net/addgene:164828 ; RRID:Addgene_164828) -
For your References section:
T cell circuits that sense antigen density with an ultrasensitive threshold. Hernandez-Lopez RA, Yu W, Cabral KA, Creasey OA, Lopez Pazmino MDP, Tonai Y, De Guzman A, Makela A, Saksela K, Gartner ZJ, Lim WA. Science. 2021 Mar 12;371(6534):1166-1171. doi: 10.1126/science.abc1855. Epub 2021 Feb 25. 10.1126/science.abc1855 PubMed 33632893