p276 eSpCas9_2gRNAs_hH11
(Plasmid
#164850)
-
PurposegRNA vector for targeting human H11 locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164850 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneeSpCas9(1.1) Addgene #71814
-
Backbone manufacturereSpCas9(1.1) Addgene #71814
- Total vector size (bp) 8936
-
Vector typeMammalian Expression
-
Selectable markersNone
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNAs for targeting human H11 locus
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI and BsaI (destroyed during cloning)
- 3′ cloning site BbsI and BsaI (destroyed during cloning)
- 5′ sequencing primer cgtgacgtagaaagtaataatt
- 3′ sequencing primer gtccctattggcgttactat
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAdditional gRNA block was cut and cloned from Addgene #64073 pX333 into Addgene #71814 eSpCas9(1.1) using restriction enzimes XbaI and KpnI
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p276 eSpCas9_2gRNAs_hH11 was a gift from Philip Jordan (Addgene plasmid # 164850 ; http://n2t.net/addgene:164850 ; RRID:Addgene_164850) -
For your References section:
Adaptation of Human Testicular Niche Cells for Pluripotent Stem Cell and Testis Development Research. Pryzhkova MV, Jordan PW. Tissue Eng Regen Med. 2020 Apr;17(2):223-235. doi: 10.1007/s13770-020-00240-0. Epub 2020 Feb 29. 10.1007/s13770-020-00240-0 PubMed 32114677