pDisplay-GRAB-HaloDA1.0-IRES-EGFP-CAAX
(Plasmid
#234410)
-
PurposeExpresses the chemigenetic dopamine (DA) sensor GRAB_HaloDA1.0 and a membrane-localized EGFP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234410 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDisplay
-
Backbone manufacturerInvitrogen
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGPCR activation based chemigenetic dopamine (DA) sensor GRAB_HaloDA1.0
-
Alt nameGRAB_HaloDA1.0
-
Alt nameHaloDA1.0
-
SpeciesH. sapiens (human)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGGGCGGTAGGCGTGTA
- 3′ sequencing primer CCTCACATTGCCAAAAGACG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.12.22.629999 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDisplay-GRAB-HaloDA1.0-IRES-EGFP-CAAX was a gift from Yulong Li (Addgene plasmid # 234410 ; http://n2t.net/addgene:234410 ; RRID:Addgene_234410) -
For your References section:
In vivo multiplex imaging of dynamic neurochemical networks with designed far-red dopamine sensors. Zheng Y, Cai R, Wang K, Zhang J, Zhuo Y, Dong H, Zhang Y, Wang Y, Deng F, Ji E, Cui Y, Fang S, Zhang X, Zhang K, Wang J, Li G, Miao X, Wang Z, Yang Y, Li S, Grimm J, Johnsson K, Schreiter E, Lavis L, Chen Z, Mu Y, Li Y. Science. 2025 Jun 5;388: 6751. doi: https://doi.org/10.1126/science.adt7705. 10.1126/science.adt7705 PubMed 39763912