p246 eSpCas9_2gRNAs_mH11
(Plasmid
#164854)
-
PurposegRNA vector for targeting mouse H11 locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164854 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneeSpCas9(1.1) Addgene #71814
-
Backbone manufacturereSpCas9(1.1) Addgene #71814
- Total vector size (bp) 8936
-
Vector typeMammalian Expression
-
Selectable markersNone
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNAs for targeting mouse H11 locus
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI and BsaI (destroyed during cloning)
- 3′ cloning site BbsI and BsaI (destroyed during cloning)
- 5′ sequencing primer cgtgacgtagaaagtaataatt
- 3′ sequencing primer gtccctattggcgttactat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAdditional gRNA block was cut and cloned from Addgene #64073 pX333 into Addgene #71814 eSpCas9(1.1) using restriction enzymes XbaI and KpnI
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p246 eSpCas9_2gRNAs_mH11 was a gift from Philip Jordan (Addgene plasmid # 164854 ; http://n2t.net/addgene:164854 ; RRID:Addgene_164854) -
For your References section:
Adaptation of the AID system for stem cell and transgenic mouse research. Pryzhkova MV, Xu MJ, Jordan PW. Stem Cell Res. 2020 Nov 5;49:102078. doi: 10.1016/j.scr.2020.102078. 10.1016/j.scr.2020.102078 PubMed 33202307