Skip to main content

pBzCas13b-gRNA-3
(Plasmid #164860)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164860 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pACYC184
  • Backbone size w/o insert (bp) 4215
  • Total vector size (bp) 4360
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BzCas13b-gRNA-3
  • gRNA/shRNA sequence
    CTCGATGTTGTGGCGGATCTTGAAGTTCAC
  • Species
    Bergeyella zoohelcum
  • Promoter J23119

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer GAACCTTCGAAAAACCGCCC
  • 3′ sequencing primer ATCTTCCCCATCGGTGATGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Spacer sequence is designed to target the mRNA of deGFP.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBzCas13b-gRNA-3 was a gift from Chase Beisel (Addgene plasmid # 164860 ; http://n2t.net/addgene:164860 ; RRID:Addgene_164860)
  • For your References section:

    Rapidly Characterizing CRISPR-Cas13 Nucleases Using Cell-Free Transcription-Translation Systems. Wandera KG, Beisel CL. Methods Mol Biol. 2022;2404:135-153. doi: 10.1007/978-1-0716-1851-6_7. 10.1007/978-1-0716-1851-6_7 PubMed 34694607