pAcrVIA4
(Plasmid
#164863)
-
PurposeInducible expression of AcrVIA4 in bacteria.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164863 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD33
- Backbone size w/o insert (bp) 4010
- Total vector size (bp) 4341
-
Modifications to backboneArabinose cassette exchanged with Insert
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAcrVIA4
-
SpeciesLeptotrichia wadei F0279
-
Insert Size (bp)331
-
GenBank IDERK48333.1
- Promoter T7 Promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATCTTCCCCATCGGTGATGTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The anti-CRISPR protein AcrVIA4 was codon-optimized for E. coli for optimal expression.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAcrVIA4 was a gift from Chase Beisel (Addgene plasmid # 164863 ; http://n2t.net/addgene:164863 ; RRID:Addgene_164863) -
For your References section:
Rapidly Characterizing CRISPR-Cas13 Nucleases Using Cell-Free Transcription-Translation Systems. Wandera KG, Beisel CL. Methods Mol Biol. 2022;2404:135-153. doi: 10.1007/978-1-0716-1851-6_7. 10.1007/978-1-0716-1851-6_7 PubMed 34694607