pLsCas13a-gRNA-1
(Plasmid
#164865)
-
PurposeConstitutive expression of single-spacer CRISPR array with spacer #1 targeting deGFP mRNA for LsCas13a in bacteria.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164865 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD18
- Backbone size w/o insert (bp) 3267
- Total vector size (bp) 3449
-
Modifications to backboneArabinose cassette exchanged by single-spacer array
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLsCas13a-gRNA-1
-
gRNA/shRNA sequenceTACGTCGCCGTCCAGCTCGACCAGGATGGGAA
-
SpeciesLeptotrichia shahii
- Promoter J23119
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer ATCTTCCCCATCGGTGATGTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Spacer sequence is designed to target the mRNA of deGFP.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLsCas13a-gRNA-1 was a gift from Chase Beisel (Addgene plasmid # 164865 ; http://n2t.net/addgene:164865 ; RRID:Addgene_164865) -
For your References section:
Rapidly Characterizing CRISPR-Cas13 Nucleases Using Cell-Free Transcription-Translation Systems. Wandera KG, Beisel CL. Methods Mol Biol. 2022;2404:135-153. doi: 10.1007/978-1-0716-1851-6_7. 10.1007/978-1-0716-1851-6_7 PubMed 34694607