Skip to main content

MSCVpic2neo-hTERT-FF2
(Plasmid #164910)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164910 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    MSCVpic2
  • Backbone size w/o insert (bp) 7166
  • Total vector size (bp) 10358
  • Vector type
    Retroviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    human telomerase reverse transcriptase
  • Alt name
    hTERT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3170
  • GenBank ID
    NM_198253.3
  • Entrez Gene
    TERT (a.k.a. CMM9, DKCA2, DKCB4, EST2, PFBMFT1, TCS1, TP2, TRT, hEST2, hTRT)
  • Tag / Fusion Protein
    • HA tag (N terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site FseI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer atgccgcgcgctccccgctg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Neuropeptide FF receptor 2
  • Alt name
    FF2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    22
  • Entrez Gene
    NPFFR2 (a.k.a. GPR74, HLWAR77, NPFF2, NPGPR)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho 1 (unknown if destroyed)
  • 3′ cloning site Eco R1 (unknown if destroyed)
  • 5′ sequencing primer cgactagggataacagggtaattg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCVpic2neo-hTERT-FF2 was a gift from Ji Luo (Addgene plasmid # 164910 ; http://n2t.net/addgene:164910 ; RRID:Addgene_164910)
  • For your References section:

    One-step immortalization of primary human airway epithelial cells capable of oncogenic transformation. Smith JL, Lee LC, Read A, Li Q, Yu B, Lee CS, Luo J. Cell Biosci. 2016 Nov 11;6:57. doi: 10.1186/s13578-016-0122-6. eCollection 2016. 10.1186/s13578-016-0122-6 PubMed 27891214