pNTI733 pRPR1(TetO)-RPC31-sgRNA
(Plasmid
#164913)
-
PurposeFor yeast genomic integration of sgRNA against RPC31
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164913 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCfB2189
- Backbone size w/o insert (bp) 6989
- Total vector size (bp) 7699
-
Vector typeYeast Expression, CRISPR
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepRPR1(TetO)-RPC31-sgRNA
-
gRNA/shRNA sequenceTTCTATAGGTTGCTGCGATG
- Promoter RPR1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tccgctctaaccgaaaaggaagg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNTI733 pRPR1(TetO)-RPC31-sgRNA was a gift from Nicholas Ingolia (Addgene plasmid # 164913 ; http://n2t.net/addgene:164913 ; RRID:Addgene_164913) -
For your References section:
CiBER-seq dissects genetic networks by quantitative CRISPRi profiling of expression phenotypes. Muller R, Meacham ZA, Ferguson L, Ingolia NT. Science. 2020 Dec 11;370(6522). pii: 370/6522/eabb9662. doi: 10.1126/science.abb9662. 10.1126/science.abb9662 PubMed 33303588