pNTI751 pPGK1-GCN4(UTR)-ZEM(TF)
(Plasmid
#164916)
-
PurposeExpresses the ZEM transcription factor under the translational control of the yeast GCN4 5'UTR
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164916 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCfB2337
- Backbone size w/o insert (bp) 6477
- Total vector size (bp) 10429
-
Vector typeYeast Expression, Synthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGCN4(UTR)-ZEM(TF)
-
SpeciesH. sapiens (human), M. musculus (mouse), S. cerevisiae (budding yeast), Synthetic
-
Insert Size (bp)3952
- Promoter PGK1 (yeast)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tccgctctaaccgaaaaggaagg
- 3′ sequencing primer tttccctgctcgcaggtctg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNTI751 pPGK1-GCN4(UTR)-ZEM(TF) was a gift from Nicholas Ingolia (Addgene plasmid # 164916 ; http://n2t.net/addgene:164916 ; RRID:Addgene_164916) -
For your References section:
CiBER-seq dissects genetic networks by quantitative CRISPRi profiling of expression phenotypes. Muller R, Meacham ZA, Ferguson L, Ingolia NT. Science. 2020 Dec 11;370(6522). pii: 370/6522/eabb9662. doi: 10.1126/science.abb9662. 10.1126/science.abb9662 PubMed 33303588