pNTI763 p(Z)-mCherry + UBC9 sgRNA
(Plasmid
#164918)
-
PurposeCEN/ARS with P(Z)-mCherry controlled by the ZEM transcription factor, also encode UBC9 sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164918 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepNTI661
- Backbone size w/o insert (bp) 4500
- Total vector size (bp) 6184
-
Modifications to backboneAdded UBC9 sgRNA target sequence
-
Vector typeYeast Expression, CRISPR
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameP(Z)-mcherry
-
SpeciesS. cerevisiae (budding yeast), Synthetic
-
Insert Size (bp)1763
- Promoter P(Z), synthetic promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ccttttgctggccttttgctc
- 3′ sequencing primer gttgacaatgattacaggttaaaagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNTI763 p(Z)-mCherry + UBC9 sgRNA was a gift from Nicholas Ingolia (Addgene plasmid # 164918 ; http://n2t.net/addgene:164918 ; RRID:Addgene_164918) -
For your References section:
CiBER-seq dissects genetic networks by quantitative CRISPRi profiling of expression phenotypes. Muller R, Meacham ZA, Ferguson L, Ingolia NT. Science. 2020 Dec 11;370(6522). pii: 370/6522/eabb9662. doi: 10.1126/science.abb9662. 10.1126/science.abb9662 PubMed 33303588