Skip to main content

pNTI763 p(Z)-mCherry + UBC9 sgRNA
(Plasmid #164918)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164918 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pNTI661
  • Backbone size w/o insert (bp) 4500
  • Total vector size (bp) 6184
  • Modifications to backbone
    Added UBC9 sgRNA target sequence
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    P(Z)-mcherry
  • Species
    S. cerevisiae (budding yeast), Synthetic
  • Insert Size (bp)
    1763
  • Promoter P(Z), synthetic promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ccttttgctggccttttgctc
  • 3′ sequencing primer gttgacaatgattacaggttaaaagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNTI763 p(Z)-mCherry + UBC9 sgRNA was a gift from Nicholas Ingolia (Addgene plasmid # 164918 ; http://n2t.net/addgene:164918 ; RRID:Addgene_164918)
  • For your References section:

    CiBER-seq dissects genetic networks by quantitative CRISPRi profiling of expression phenotypes. Muller R, Meacham ZA, Ferguson L, Ingolia NT. Science. 2020 Dec 11;370(6522). pii: 370/6522/eabb9662. doi: 10.1126/science.abb9662. 10.1126/science.abb9662 PubMed 33303588