Skip to main content

pInducer10b-HA-KRAS G12V CO SR
(Plasmid #164928)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164928 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pInducer-10b
  • Backbone size w/o insert (bp) 12168
  • Total vector size (bp) 12778
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KRAS proto-oncogene, GTPase (KRAS)
  • Alt name
    KRAS
  • Species
    H. sapiens (human)
  • Mutation
    Glycine 12 changed to valine; 9 Valine codons are optimized and siRNA targeting sites are altered without effecting amino acid codons..
  • GenBank ID
    NM_004985.5
  • Entrez Gene
    KRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
  • Promoter Ubc promoter
  • Tag / Fusion Protein
    • HA tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site Mlu I (unknown if destroyed)
  • 5′ sequencing primer ctaccggtagatctaccatg
  • 3′ sequencing primer ctgatccttccgcccggacgctcag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pInducer10b-HA-KRAS G12V CO SR was a gift from Ji Luo (Addgene plasmid # 164928 ; http://n2t.net/addgene:164928 ; RRID:Addgene_164928)
  • For your References section:

    Development of siRNA payloads to target KRAS-mutant cancer. Yuan TL, Fellmann C, Lee CS, Ritchie CD, Thapar V, Lee LC, Hsu DJ, Grace D, Carver JO, Zuber J, Luo J, McCormick F, Lowe SW. Cancer Discov. 2014 Oct;4(10):1182-1197. doi: 10.1158/2159-8290.CD-13-0900. Epub 2014 Aug 6. 10.1158/2159-8290.CD-13-0900 PubMed 25100204