Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLJM1 FLCN (WT) FLAG GFP
(Plasmid #164978)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 164978 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLJM1
  • Modifications to backbone
    CMV promoter was switched to UCB promoter
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FLCN
  • Alt name
    Folliculin
  • Species
    H. sapiens (human)
  • Entrez Gene
    FLCN (a.k.a. BHD, DENND8B, FLCL)
  • Promoter UBC
  • Tag / Fusion Protein
    • 1xFLAG-GFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer hUBC-F: TGAAGCTCCGGTTTTGAACT
  • 3′ sequencing primer pLJM1-R: GACGTGAAGAATGTGCGAGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLJM1 FLCN (WT) FLAG GFP was a gift from Roberto Zoncu (Addgene plasmid # 164978 ; http://n2t.net/addgene:164978 ; RRID:Addgene_164978)
  • For your References section:

    Structural mechanism of a Rag GTPase activation checkpoint by the lysosomal folliculin complex. Lawrence RE, Fromm SA, Fu Y, Yokom AL, Kim DJ, Thelen AM, Young LN, Lim CY, Samelson AJ, Hurley JH, Zoncu R. Science. 2019 Nov 22;366(6468):971-977. doi: 10.1126/science.aax0364. Epub 2019 Oct 31. 10.1126/science.aax0364 PubMed 31672913