GFP-LaM(N)-cpFRB1-T2A-FKBP-LaM(C)
(Plasmid
#165026)
-
PurposeExpress cpFRB1-based mCherry specific Chessbody (chemically switchable split nanobody); visualized by GFP
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 165026 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTriEX
- Backbone size w/o insert (bp) 5682
- Total vector size (bp) 6849
-
Vector typeMammalian Expression, Bacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLaM8(N)-cpFRB1-T2A-FKBP-LaM8(C)
-
SpeciesSynthetic
-
Insert Size (bp)1167
- Promoter T7
-
Tag
/ Fusion Protein
- GFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer EGFPC1F
- 3′ sequencing primer atctcagtggtatttgtgagccag (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-LaM(N)-cpFRB1-T2A-FKBP-LaM(C) was a gift from Yubin Zhou (Addgene plasmid # 165026 ; http://n2t.net/addgene:165026 ; RRID:Addgene_165026) -
For your References section:
Expanding the Chemogenetic Toolbox by Circular Permutation. Lee YT, He L, Zhou Y. J Mol Biol. 2020 May 1;432(10):3127-3136. doi: 10.1016/j.jmb.2020.03.033. Epub 2020 Apr 8. 10.1016/j.jmb.2020.03.033 PubMed 32277990