aav-tnt-actn2-gfp
(Plasmid
#165034)
-
PurposeAAV-based delivery of ACTN2-GFP into cardiomyocytes in vivo
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 165034 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneaav-tnt-gfp-v2
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameACTN2
-
SpeciesM. musculus (mouse)
-
Entrez GeneActn2 (a.k.a. 1110008F24Rik)
- Promoter cTNT
-
Tag
/ Fusion Protein
- GFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer GTGTCCACTCCCAGTTCAATTACAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
aav-tnt-actn2-gfp was a gift from William Pu (Addgene plasmid # 165034 ; http://n2t.net/addgene:165034 ; RRID:Addgene_165034) -
For your References section:
Sarcomeres regulate murine cardiomyocyte maturation through MRTF-SRF signaling. Guo Y, Cao Y, Jardin BD, Sethi I, Ma Q, Moghadaszadeh B, Troiano EC, Mazumdar N, Trembley MA, Small EM, Yuan GC, Beggs AH, Pu WT. Proc Natl Acad Sci U S A. 2021 Jan 12;118(2). pii: 2008861118. doi: 10.1073/pnas.2008861118. 10.1073/pnas.2008861118 PubMed 33361330