Skip to main content

aav-tnt-wtmrtfa-gfp
(Plasmid #165037)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 165037 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    aav-tnt-gfp-v2
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Mrtfa
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Mrtfa (a.k.a. AMKL, Bsac, Mal, Mkl1, Mrtf-A)
  • Promoter cTNT
  • Tag / Fusion Protein
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer GTGTCCACTCCCAGTTCAATTACAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the Addgene verified sequence detected a 22bp deletion in the ITR region. This deletion does not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    aav-tnt-wtmrtfa-gfp was a gift from William Pu (Addgene plasmid # 165037 ; http://n2t.net/addgene:165037 ; RRID:Addgene_165037)
  • For your References section:

    Sarcomeres regulate murine cardiomyocyte maturation through MRTF-SRF signaling. Guo Y, Cao Y, Jardin BD, Sethi I, Ma Q, Moghadaszadeh B, Troiano EC, Mazumdar N, Trembley MA, Small EM, Yuan GC, Beggs AH, Pu WT. Proc Natl Acad Sci U S A. 2021 Jan 12;118(2). pii: 2008861118. doi: 10.1073/pnas.2008861118. 10.1073/pnas.2008861118 PubMed 33361330