aav-tnt-wtmrtfa-gfp
(Plasmid
#165037)
-
PurposeAAV-based delivery of wtMRTFA-GFP into cardiomyocytes in vivo
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 165037 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneaav-tnt-gfp-v2
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMrtfa
-
SpeciesM. musculus (mouse)
-
Entrez GeneMrtfa (a.k.a. AMKL, Bsac, Mal, Mkl1, Mrtf-A)
- Promoter cTNT
-
Tag
/ Fusion Protein
- GFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer GTGTCCACTCCCAGTTCAATTACAG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the Addgene verified sequence detected a 22bp deletion in the ITR region. This deletion does not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
aav-tnt-wtmrtfa-gfp was a gift from William Pu (Addgene plasmid # 165037 ; http://n2t.net/addgene:165037 ; RRID:Addgene_165037) -
For your References section:
Sarcomeres regulate murine cardiomyocyte maturation through MRTF-SRF signaling. Guo Y, Cao Y, Jardin BD, Sethi I, Ma Q, Moghadaszadeh B, Troiano EC, Mazumdar N, Trembley MA, Small EM, Yuan GC, Beggs AH, Pu WT. Proc Natl Acad Sci U S A. 2021 Jan 12;118(2). pii: 2008861118. doi: 10.1073/pnas.2008861118. 10.1073/pnas.2008861118 PubMed 33361330