Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Nsp4 deltaC-EGFP
(Plasmid #165126)


Item Catalog # Description Quantity Price (USD)
Plasmid 165126 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Nsp4 deltaC
  • Species
    codon optimized SARS-COV-2
  • Insert Size (bp)
  • Entrez Gene
    ORF1ab (a.k.a. GU280_gp01)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer GTCGTAACAACTCCGCCC
  • 3′ sequencing primer CGTCCAGCTCGACCAGGATG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Inserts were prepared by PCR with templates that have been published elsewhere: Gordon et al., 2020a.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit for BioRxiv preprint. bioRxiv 2020.12.19.423586v1

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Nsp4 deltaC-EGFP was a gift from Bruno Antonny (Addgene plasmid # 165126 ; ; RRID:Addgene_165126)
  • For your References section:

    A comprehensive library of fluorescent constructs of SARS-CoV-2 proteins and their initial characterisation in different cell types. Miserey-Lenkei S, Trajkovic K, D'Ambrosio JM, Patel AJ, Copic A, Mathur P, Schauer K, Goud B, Albanese V, Gautier R, Subra M, Kovacs D, Barelli H, Antonny B. Biol Cell. 2021 Jul;113(7):311-328. doi: 10.1111/boc.202000158. Epub 2021 May 10. 10.1111/boc.202000158 PubMed 33666950