Skip to main content

pDDGFP-Leu2d_GgPCFT
(Plasmid #165414)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 165414 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDDGFP_LEU2d
  • Backbone size w/o insert (bp) 8654
  • Total vector size (bp) 10000
  • Vector type
    Yeast Expression
  • Selectable markers
    LEU2, URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GgPCFT
  • Species
    G. gallus (chicken), Synthetic
  • Insert Size (bp)
    1419
  • GenBank ID
  • Entrez Gene
    SLC46A1 (a.k.a. PCFT)
  • Promoter GAL1
  • Tag / Fusion Protein
    • GFP-His8 (C terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer cttcttattcaaatgtaa
  • 3′ sequencing primer agaaaatttgtgaccattaac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDDGFP-Leu2d_GgPCFT was a gift from Simon Newstead (Addgene plasmid # 165414 ; http://n2t.net/addgene:165414 ; RRID:Addgene_165414)
  • For your References section:

    Structural basis of antifolate recognition and transport by PCFT. Parker JL, Deme JC, Kuteyi G, Wu Z, Huo J, Goldman ID, Owens RJ, Biggin PC, Lea SM, Newstead S. Nature. 2021 May 26. pii: 10.1038/s41586-021-03579-z. doi: 10.1038/s41586-021-03579-z. 10.1038/s41586-021-03579-z PubMed 34040256