pDDGFP-Leu2d_GgPCFT
(Plasmid
#165414)
-
Purposeexpression GgPCFT protein with C terminally tagged GFP-His tag cleavable with TEV protease.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 165414 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDDGFP_LEU2d
- Backbone size w/o insert (bp) 8654
- Total vector size (bp) 10000
-
Vector typeYeast Expression
-
Selectable markersLEU2, URA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGgPCFT
-
SpeciesG. gallus (chicken), Synthetic
-
Insert Size (bp)1419
-
GenBank ID
-
Entrez GeneSLC46A1 (a.k.a. PCFT)
- Promoter GAL1
-
Tag
/ Fusion Protein
- GFP-His8 (C terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer cttcttattcaaatgtaa
- 3′ sequencing primer agaaaatttgtgaccattaac
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDDGFP-Leu2d_GgPCFT was a gift from Simon Newstead (Addgene plasmid # 165414 ; http://n2t.net/addgene:165414 ; RRID:Addgene_165414) -
For your References section:
Structural basis of antifolate recognition and transport by PCFT. Parker JL, Deme JC, Kuteyi G, Wu Z, Huo J, Goldman ID, Owens RJ, Biggin PC, Lea SM, Newstead S. Nature. 2021 May 26. pii: 10.1038/s41586-021-03579-z. doi: 10.1038/s41586-021-03579-z. 10.1038/s41586-021-03579-z PubMed 34040256