pSico_U6-Pan-PGC1a sgRNA
(Plasmid
#165426)
-
PurposeExpression of gRNA against human Total PGC-1a variants
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 165426 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSico
- Backbone size w/o insert (bp) 9580
- Total vector size (bp) 9600
-
Modifications to backbonemKate2-T2A-Bsd cassette included on backbone driven by CAGs promoter
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA against human Total PGC-1a variants
-
gRNA/shRNA sequenceCC GGG ATA AAG TGT CAT CAT
-
SpeciesH. sapiens (human), Synthetic
-
GenBank ID
-
Entrez GenePPARGC1A (a.k.a. LEM6, PGC-1(alpha), PGC-1alpha, PGC-1v, PGC1, PGC1A, PPARGC1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Esp3I (destroyed during cloning)
- 3′ cloning site Esp3I (destroyed during cloning)
- 5′ sequencing primer CCTCTGCTAACCATGTTCATGC
- 3′ sequencing primer GATCTACCACATTTGTAGAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSico_U6-Pan-PGC1a sgRNA was a gift from Antonio Amelio (Addgene plasmid # 165426 ; http://n2t.net/addgene:165426 ; RRID:Addgene_165426) -
For your References section:
CRTC1/MAML2 directs a PGC-1alpha-IGF-1 circuit that confers vulnerability to PPARgamma inhibition. Musicant AM, Parag-Sharma K, Gong W, Sengupta M, Chatterjee A, Henry EC, Tsai YH, Hayward MC, Sheth S, Betancourt R, Hackman TG, Padilla RJ, Parker JS, Giudice J, Flaveny CA, Hayes DN, Amelio AL. Cell Rep. 2021 Feb 23;34(8):108768. doi: 10.1016/j.celrep.2021.108768. 10.1016/j.celrep.2021.108768 PubMed 33626346