-
PurposeLentiviral vector with puro selection for expression of S. aureus dCas9-KRAB
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 106249 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneFUGW
- Backbone size w/o insert (bp) 10000
- Total vector size (bp) 14000
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedead S. aureus Cas9 KRAB T2A PuroR
-
Alt namenuclease deactivated SauCas9
-
SpeciesS. aureus
-
MutationD10A and N580A
- Promoter hUbC
-
Tags
/ Fusion Proteins
- HA-NLS (N terminal on insert)
- NLS-KRAB (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gttggcgagtgtgttttgtg
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV hUbC-dSaCas9-KRAB-T2A-PuroR was a gift from Charles Gersbach (Addgene plasmid # 106249 ; http://n2t.net/addgene:106249 ; RRID:Addgene_106249) -
For your References section:
RNA-guided transcriptional silencing in vivo with S. aureus CRISPR-Cas9 repressors. Thakore PI, Kwon JB, Nelson CE, Rouse DC, Gemberling MP, Oliver ML, Gersbach CA. Nat Commun. 2018 Apr 26;9(1):1674. doi: 10.1038/s41467-018-04048-4. 10.1038/s41467-018-04048-4 PubMed 29700298