Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pSico_U6-Pan-PGC1a sgRNA
(Plasmid #165426)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 165426 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSico
  • Backbone size w/o insert (bp) 9580
  • Total vector size (bp) 9600
  • Modifications to backbone
    mKate2-T2A-Bsd cassette included on backbone driven by CAGs promoter
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA against human Total PGC-1a variants
  • gRNA/shRNA sequence
    CC GGG ATA AAG TGT CAT CAT
  • Species
    H. sapiens (human), Synthetic
  • GenBank ID
  • Entrez Gene
    PPARGC1A (a.k.a. LEM6, PGC-1(alpha), PGC-1alpha, PGC-1v, PGC1, PGC1A, PPARGC1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Esp3I (destroyed during cloning)
  • 3′ cloning site Esp3I (destroyed during cloning)
  • 5′ sequencing primer CCTCTGCTAACCATGTTCATGC
  • 3′ sequencing primer GATCTACCACATTTGTAGAG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSico_U6-Pan-PGC1a sgRNA was a gift from Antonio Amelio (Addgene plasmid # 165426 ; http://n2t.net/addgene:165426 ; RRID:Addgene_165426)
  • For your References section:

    CRTC1/MAML2 directs a PGC-1alpha-IGF-1 circuit that confers vulnerability to PPARgamma inhibition. Musicant AM, Parag-Sharma K, Gong W, Sengupta M, Chatterjee A, Henry EC, Tsai YH, Hayward MC, Sheth S, Betancourt R, Hackman TG, Padilla RJ, Parker JS, Giudice J, Flaveny CA, Hayes DN, Amelio AL. Cell Rep. 2021 Feb 23;34(8):108768. doi: 10.1016/j.celrep.2021.108768. 10.1016/j.celrep.2021.108768 PubMed 33626346