-
PurposeTetracycline inducible CRE expression from AAVS1 locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 165457 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneAAVS1-Neo
- Backbone size w/o insert (bp) 10785
- Total vector size (bp) 11817
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCRE
-
Insert Size (bp)1032
- Promoter Tight TRE promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CTAGTAAAGCTTAGTACTGTCGAGTTTAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCre recombinase cDNA was amplified from pCAG-Cre, a gift from Dr Connie Cepko, Addgene plasmid # 13775
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-Neo-TRE-CMV-Cre-rtTA was a gift from Madeline Lancaster (Addgene plasmid # 165457 ; http://n2t.net/addgene:165457 ; RRID:Addgene_165457) -
For your References section:
An early cell shape transition drives evolutionary expansion of the human forebrain. Benito-Kwiecinski S, Giandomenico SL, Sutcliffe M, Riis ES, Freire-Pritchett P, Kelava I, Wunderlich S, Martin U, Wray GA, McDole K, Lancaster MA. Cell. 2021 Apr 15;184(8):2084-2102.e19. doi: 10.1016/j.cell.2021.02.050. Epub 2021 Mar 24. 10.1016/j.cell.2021.02.050 PubMed 33765444