pEXPqcxip-hFTSJ3-FLAG
(Plasmid
#165463)
-
PurposeHuman FTSJ3 retroviral mammalian expression vector. FLAG/Gateway modified pQCXIP vector with C-terminal FLAG epitope and bicistronic puromycin expression.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 165463 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepQCXIP Gateway modified
-
Backbone manufacturerClontech /Takara
- Backbone size w/o insert (bp) 7200
-
Vector typeMammalian Expression, Retroviral ; Gateway
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFtsJ RNA 2'-O-methyltransferase 3
-
Alt nameFTSJ3, SPB1, EPCS3
-
Alt nameBC036710
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2541
-
Entrez GeneFTSJ3 (a.k.a. EPCS3, SPB1)
- Promoter CMV/MSV, 5'LTR
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer acgccatccacgctgttttgacct
- 3′ sequencing primer gggcggaattccggat (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byHarvard Institute of Proteomics clone ID.s: HsCD00041273, FLH185237.01L
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This Expression vector derived from recombination of HIP Gateway Entry clone HsCD00041273 with a Destination vector, which is pQCXIP modified with a Gateway cassette, and a C-terminal FLAG. Construct has 25bp attB sequences surrounding the insert: attB1-ccacc-[FTSJ3 CDS no stop 2541bp]-ttgg-attB2(25bp)-g-FLAG (24bp)-tga(stop)-IRES-puromycin. pQCXIP is a self inactivating retroviral vector (only in a host cell) and has bicistronic expression of puromycin on the same transcript as the insert. Note, some CMV primers land more than one time.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEXPqcxip-hFTSJ3-FLAG was a gift from Martin Dorf (Addgene plasmid # 165463 ; http://n2t.net/addgene:165463 ; RRID:Addgene_165463) -
For your References section:
TRIM65 regulates microRNA activity by ubiquitination of TNRC6. Li S, Wang L, Fu B, Berman MA, Diallo A, Dorf ME. Proc Natl Acad Sci U S A. 2014 May 13;111(19):6970-5. doi: 10.1073/pnas.1322545111. Epub 2014 Apr 28. 10.1073/pnas.1322545111 PubMed 24778252