Skip to main content

pEXPqcxip-hFTSJ3-FLAG
(Plasmid #165463)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 165463 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pQCXIP Gateway modified
  • Backbone manufacturer
    Clontech /Takara
  • Backbone size w/o insert (bp) 7200
  • Vector type
    Mammalian Expression, Retroviral ; Gateway
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FtsJ RNA 2'-O-methyltransferase 3
  • Alt name
    FTSJ3, SPB1, EPCS3
  • Alt name
    BC036710
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2541
  • Entrez Gene
    FTSJ3 (a.k.a. EPCS3, SPB1)
  • Promoter CMV/MSV, 5'LTR
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer acgccatccacgctgttttgacct
  • 3′ sequencing primer gggcggaattccggat
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Harvard Institute of Proteomics clone ID.s: HsCD00041273, FLH185237.01L

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This Expression vector derived from recombination of HIP Gateway Entry clone HsCD00041273 with a Destination vector, which is pQCXIP modified with a Gateway cassette, and a C-terminal FLAG. Construct has 25bp attB sequences surrounding the insert: attB1-ccacc-[FTSJ3 CDS no stop 2541bp]-ttgg-attB2(25bp)-g-FLAG (24bp)-tga(stop)-IRES-puromycin. pQCXIP is a self inactivating retroviral vector (only in a host cell) and has bicistronic expression of puromycin on the same transcript as the insert. Note, some CMV primers land more than one time.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEXPqcxip-hFTSJ3-FLAG was a gift from Martin Dorf (Addgene plasmid # 165463 ; http://n2t.net/addgene:165463 ; RRID:Addgene_165463)
  • For your References section:

    TRIM65 regulates microRNA activity by ubiquitination of TNRC6. Li S, Wang L, Fu B, Berman MA, Diallo A, Dorf ME. Proc Natl Acad Sci U S A. 2014 May 13;111(19):6970-5. doi: 10.1073/pnas.1322545111. Epub 2014 Apr 28. 10.1073/pnas.1322545111 PubMed 24778252