pRB30-GFP
(Plasmid
#165481)
-
Purpose(Empty Backbone) pTriEx based vector for protein expression in mammalian cells for targets fused with C-terminal uv-GFP, Flag and His
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 165481 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTriEx-1.1
-
Backbone manufacturerNovagen
-
Vector typeMammalian Expression
-
Tag
/ Fusion Protein
- TEV-GFP-FLAG-10x His (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNone
-
Tag
/ Fusion Protein
- TEV-GFP-FLAG-10x His (C terminal on backbone)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Primers for LIC cloning: Upstream: add TTAAGAAGGAGATATACT to the 5' end of gene of interest. Downstream: add GATTGGAAGTAGAGGTTCTCTGC to the 3' end of GOI. For vector: digest with BfuAI (BspMI) before LIC-treatment. Detailed cloning method available in the paper Bruni R, Kloss B. High-throughput cloning and expression of integral membrane proteins in Escherichia coli. Curr Protoc Protein Sci. 2013 Nov 5;74:29.6.1-29.6.34.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRB30-GFP was a gift from Renato Bruni (Addgene plasmid # 165481 ; http://n2t.net/addgene:165481 ; RRID:Addgene_165481) -
For your References section:
High-throughput cloning and expression of integral membrane proteins in Escherichia coli. Bruni R, Kloss B. Curr Protoc Protein Sci. 2013 Nov 5;74:29.6.1-29.6.34. doi: 10.1002/0471140864.ps2906s74. 10.1002/0471140864.ps2906s74 PubMed 24510647