Skip to main content
Addgene

pGEM-HE-bPAC(R278A)-Myc-eYFP
(Plasmid #165488)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 165488 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGEM HE
  • Backbone size w/o insert (bp) 3062
  • Total vector size (bp) 4886
  • Modifications to backbone
    pGEM-HE is a derivative of pGEM3Z vector(Promega) modified after Liman, E.R., Tytgat, J. & Hess,P.; Neuron 9, 1992
  • Vector type
    Bacterial Expression ; cDNA expression, Xenopus Oocyte

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    bPAC(R278A)-Myc-eYFP
  • Alt name
    bPAC(R278A)-eYFP
  • Species
    Synthetic; Beggiatoa
  • Insert Size (bp)
    1824
  • Promoter T7
  • Tags / Fusion Proteins
    • Myc (C terminal on insert)
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer gaattaattcgagctcggtac
  • 3′ sequencing primer gtgtaagttggtattatgtag
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Plasmid was assembled in the lab of Georg Nagel

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEM-HE-bPAC(R278A)-Myc-eYFP was a gift from Thomas Oertner (Addgene plasmid # 165488 ; http://n2t.net/addgene:165488 ; RRID:Addgene_165488)
  • For your References section:

    PACmn for improved optogenetic control of intracellular cAMP. Yang S, Constantin OM, Sachidanandan D, Hofmann H, Kunz TC, Kozjak-Pavlovic V, Oertner TG, Nagel G, Kittel RJ, Gee CE, Gao S. BMC Biol. 2021 Oct 18;19(1):227. doi: 10.1186/s12915-021-01151-9. 10.1186/s12915-021-01151-9 PubMed 34663304