pCcmO-StrepII-PDT
(Plasmid
#165584)
-
PurposeNative CcmO fusion with a StrepII tag and PDT
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 165584 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC57
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCcmO-PDT
-
SpeciesSynechococcus elongatus PCC 7942
-
Tag
/ Fusion Protein
- Protein degradation tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATCAGAATGTTGGCGCGATTGG
- 3′ sequencing primer AGTTTGTAGTCCTTCACCCCGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCcmO-StrepII-PDT was a gift from Daniel Ducat (Addgene plasmid # 165584 ; http://n2t.net/addgene:165584 ; RRID:Addgene_165584) -
For your References section:
Orthogonal Degron System for Controlled Protein Degradation in Cyanobacteria. Sakkos JK, Hernandez-Ortiz S, Osteryoung KW, Ducat DC. ACS Synth Biol. 2021 Jul 16;10(7):1667-1681. doi: 10.1021/acssynbio.1c00035. Epub 2021 Jul 7. 10.1021/acssynbio.1c00035 PubMed 34232633