Skip to main content

pCcmO-StrepII-PDT
(Plasmid #165584)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 165584 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC57
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CcmO-PDT
  • Species
    Synechococcus elongatus PCC 7942
  • Tag / Fusion Protein
    • Protein degradation tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATCAGAATGTTGGCGCGATTGG
  • 3′ sequencing primer AGTTTGTAGTCCTTCACCCCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCcmO-StrepII-PDT was a gift from Daniel Ducat (Addgene plasmid # 165584 ; http://n2t.net/addgene:165584 ; RRID:Addgene_165584)
  • For your References section:

    Orthogonal Degron System for Controlled Protein Degradation in Cyanobacteria. Sakkos JK, Hernandez-Ortiz S, Osteryoung KW, Ducat DC. ACS Synth Biol. 2021 Jul 16;10(7):1667-1681. doi: 10.1021/acssynbio.1c00035. Epub 2021 Jul 7. 10.1021/acssynbio.1c00035 PubMed 34232633