Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pUCM-CLYBL-NGN2-BRN3A
(Plasmid #165597)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 165597 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUCM
  • Backbone manufacturer
    Custom
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 13048
  • Modifications to backbone
    Homology arms to CLYBL safe-harbor site
  • Vector type
    Mammalian Expression, CRISPR, TALEN
  • Selectable markers
    Puromycin ; SBP-LNGFR for streptavidin bead selection

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Neurogenin 2
  • Alt name
    NGN2
  • Alt name
    NEUROG2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    816
  • GenBank ID
    NM_024019
  • Entrez Gene
    NEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
  • Promoter TRE3G

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCTCGTTTAGTGAACCGTCAG
  • 3′ sequencing primer TTCTCTTCCACGTCGCCACATGTC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    BRN3A
  • Alt name
    POU4F1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1260
  • GenBank ID
    NM_006237
  • Entrez Gene
    POU4F1 (a.k.a. BRN3A, Oct-T1, RDC-1, brn-3A)
  • Promoter TRE3G

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer GCCCGGGATTGCATCAT
  • 3′ sequencing primer CAATCAGAGGCAGAAACAGA
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    EGFP
  • Alt name
    Enhanced green fluorescent protein
  • Insert Size (bp)
    717
  • Promoter EF-1alpha

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gtgaccggcgcctacgctag
  • 3′ sequencing primer agaagacttcctctgccctc
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    Puromycin N-acetyl transferase
  • Alt name
    PuroR
  • Insert Size (bp)
    600
  • Promoter EF-1alpha

Cloning Information for Gene/Insert 4

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcagaggaagtcttctaacatg
  • 3′ sequencing primer CCCCCAGAATAGAATGACACC
  • (Common Sequencing Primers)

Gene/Insert 5

  • Gene/Insert name
    rtTA3G
  • Insert Size (bp)
    748
  • Promoter CAG

Cloning Information for Gene/Insert 5

  • Cloning method Unknown
  • 5′ sequencing primer ctggttattgtgctgtctc
  • 3′ sequencing primer GTCAGATGCTCAAGGGGCTT
  • (Common Sequencing Primers)

Gene/Insert 6

  • Gene/Insert name
    SBP Delta-LNGFR
  • Insert Size (bp)
    870
  • Promoter Endogenous CLYBL (splice acceptor)

Cloning Information for Gene/Insert 6

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cccaggttacaagctttaca
  • 3′ sequencing primer caccggagcgatcgcagatc
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUCM-CLYBL-NGN2-BRN3A was a gift from Carsten Bönnemann (Addgene plasmid # 165597 ; http://n2t.net/addgene:165597 ; RRID:Addgene_165597)
  • For your References section:

    Transcriptional Programming of Human Mechanosensory Neuron Subtypes from Pluripotent Stem Cells. Nickolls AR, Lee MM, Espinoza DF, Szczot M, Lam RM, Wang Q, Beers J, Zou J, Nguyen MQ, Solinski HJ, AlJanahi AA, Johnson KR, Ward ME, Chesler AT, Bonnemann CG. Cell Rep. 2020 Jan 21;30(3):932-946.e7. doi: 10.1016/j.celrep.2019.12.062. 10.1016/j.celrep.2019.12.062 PubMed 31968264