pUCM-CLYBL-NGN2-BRN3A
(Plasmid #165597)

• Purpose: Donor construct for insertion of NGN2 and BRN3A into the CLYBL safe harbor site. This is an all-in-one doxycycline-inducible construct, enabling iPSC differentiation into peripheral sensory neurons.
• Depositing Lab: Carsten Bönnemann
• Publication: Nickolls et al Cell Rep. 2020 Jan 21;30(3):932-946.e7. doi: 10.1016/j.celrep.2019.12.062.

Backbone

• Vector backbone: pUCM
• Backbone manufacturer: Custom
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 13048
• Modifications to backbone: Homology arms to CLYBL safe-harbor site
• Vector type: Mammalian Expression, CRISPR, TALEN
• Selectable markers: Puromycin ; SBP-LNGFR for streptavidin bead selection

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Neurogenin 2
• Alt name: NGN2
• Alt name: NEUROG2
• Species: H. sapiens (human)
• Insert Size (bp): 816
• GenBank ID: NM_024019
• Entrez Gene: NEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
• Promoter: TRE3G

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCTCGTTTAGTGAACCGTCAG
• 3′ sequencing primer: TTCTCTTCCACGTCGCCACATGTC

Gene/Insert 2

• Gene/Insert name: BRN3A
• Alt name: POU4F1
• Species: H. sapiens (human)
• Insert Size (bp): 1260
• GenBank ID: NM_006237
• Entrez Gene: POU4F1 (a.k.a. ATITHS, BRN3A, Oct-T1, RDC-1, brn-3A)
• Promoter: TRE3G

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: ClaI (not destroyed)
• 5′ sequencing primer: GCCCGGGATTGCATCAT
• 3′ sequencing primer: CAATCAGAGGCAGAAACAGA

Gene/Insert 3

• Gene/Insert name: EGFP
• Alt name: Enhanced green fluorescent protein
• Insert Size (bp): 717
• Promoter: EF-1alpha

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gtgaccggcgcctacgctag
• 3′ sequencing primer: agaagacttcctctgccctc

Gene/Insert 4

• Gene/Insert name: Puromycin N-acetyl transferase
• Alt name: PuroR
• Insert Size (bp): 600
• Promoter: EF-1alpha

Cloning Information for Gene/Insert 4

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gcagaggaagtcttctaacatg
• 3′ sequencing primer: CCCCCAGAATAGAATGACACC

Gene/Insert 5

• Gene/Insert name: rtTA3G
• Insert Size (bp): 748
• Promoter: CAG

Cloning Information for Gene/Insert 5

• Cloning method: Unknown
• 5′ sequencing primer: ctggttattgtgctgtctc
• 3′ sequencing primer: GTCAGATGCTCAAGGGGCTT

Gene/Insert 6

• Gene/Insert name: SBP Delta-LNGFR
• Insert Size (bp): 870
• Promoter: Endogenous CLYBL (splice acceptor)

Cloning Information for Gene/Insert 6

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cccaggttacaagctttaca
• 3′ sequencing primer: caccggagcgatcgcagatc

Resource Information

• Supplemental Documents:
  • pUCM-CLYBL-NGN2-BRN3A.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry