-
PurposeDonor construct for insertion of NGN2 and BRN3A into the CLYBL safe harbor site. This is an all-in-one doxycycline-inducible construct, enabling iPSC differentiation into peripheral sensory neurons.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 165597 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUCM
-
Backbone manufacturerCustom
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 13048
-
Modifications to backboneHomology arms to CLYBL safe-harbor site
-
Vector typeMammalian Expression, CRISPR, TALEN
-
Selectable markersPuromycin ; SBP-LNGFR for streptavidin bead selection
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameNeurogenin 2
-
Alt nameNGN2
-
Alt nameNEUROG2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)816
-
GenBank IDNM_024019
-
Entrez GeneNEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
- Promoter TRE3G
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTCGTTTAGTGAACCGTCAG
- 3′ sequencing primer TTCTCTTCCACGTCGCCACATGTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameBRN3A
-
Alt namePOU4F1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1260
-
GenBank IDNM_006237
-
Entrez GenePOU4F1 (a.k.a. ATITHS, BRN3A, Oct-T1, RDC-1, brn-3A)
- Promoter TRE3G
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer GCCCGGGATTGCATCAT
- 3′ sequencing primer CAATCAGAGGCAGAAACAGA (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameEGFP
-
Alt nameEnhanced green fluorescent protein
-
Insert Size (bp)717
- Promoter EF-1alpha
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer gtgaccggcgcctacgctag
- 3′ sequencing primer agaagacttcctctgccctc (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert namePuromycin N-acetyl transferase
-
Alt namePuroR
-
Insert Size (bp)600
- Promoter EF-1alpha
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer gcagaggaagtcttctaacatg
- 3′ sequencing primer CCCCCAGAATAGAATGACACC (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert namertTA3G
-
Insert Size (bp)748
- Promoter CAG
Cloning Information for Gene/Insert 5
- Cloning method Unknown
- 5′ sequencing primer ctggttattgtgctgtctc
- 3′ sequencing primer GTCAGATGCTCAAGGGGCTT (Common Sequencing Primers)
Gene/Insert 6
-
Gene/Insert nameSBP Delta-LNGFR
-
Insert Size (bp)870
- Promoter Endogenous CLYBL (splice acceptor)
Cloning Information for Gene/Insert 6
- Cloning method Gibson Cloning
- 5′ sequencing primer cccaggttacaagctttaca
- 3′ sequencing primer caccggagcgatcgcagatc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUCM-CLYBL-NGN2-BRN3A was a gift from Carsten Bönnemann (Addgene plasmid # 165597 ; http://n2t.net/addgene:165597 ; RRID:Addgene_165597) -
For your References section:
Transcriptional Programming of Human Mechanosensory Neuron Subtypes from Pluripotent Stem Cells. Nickolls AR, Lee MM, Espinoza DF, Szczot M, Lam RM, Wang Q, Beers J, Zou J, Nguyen MQ, Solinski HJ, AlJanahi AA, Johnson KR, Ward ME, Chesler AT, Bonnemann CG. Cell Rep. 2020 Jan 21;30(3):932-946.e7. doi: 10.1016/j.celrep.2019.12.062. 10.1016/j.celrep.2019.12.062 PubMed 31968264