PB-TO-oNGN2
(Plasmid #198397)

• Purpose: Piggybac Tet-ON plasmid for differentiating hiPSCs into glutamatergic neurons via NGN2 expression. oNGN2 is a Phospho-mutant which avoids inhibition by cdk kinase, NGN2 optimization aided by IDT tool.
• Depositing Labs: iPSC Neurodegenerative Disease Initiative (iNDI), Michael Ward
• Publication: Characterization of iPSC lines for the iPSC Neurodegenerative Disease Initiative (iNDI) (unpublished)

Backbone

• Vector backbone: pUCM
• Backbone size w/o insert (bp): 13243
• Total vector size (bp): 14098
• Modifications to backbone: x y z
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: 100µg/mL
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: NEUROG2 (phospho mutant, codon optimized)
• Alt name: hNGN2
• Species: H. sapiens (human)
• Insert Size (bp): 819
• Mutation: S24A, S193A, S207A, S209A, S219A, S232A, S239A, S242A
• Entrez Gene: NEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
• Promoter: TRE3G

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHi (not destroyed)
• 3′ cloning site: PmeI (not destroyed)
• 5′ sequencing primer: ccgtaccacttcctaccctc

Gene/Insert 2

• Gene/Insert name: puroR-T2A-mycNLS-mTagBFP2
• Species: H. sapiens (human)
• Insert Size (bp): 1476
• Promoter: EF1a
• Tag / Fusion Protein:
  • T2A-mycNLS-mTagBFP2

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: SwaI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC

Gene/Insert 3

• Gene/Insert name: rtTA3G
• Species: H. sapiens (human)
• Insert Size (bp): 748
• Promoter: CAG

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: ctggttattgtgctgtctc

Resource Information

• Supplemental Documents:
  • iC13 PB-TO-oNgn2-BFP-puro[44].gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • piggyBac Limited Use Label License
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry