pSB3K3-101-phzAG
(Plasmid
#165617)
-
PurposeConstitutive expression of phzAG operon for phenazine-1-carboxylic acid production
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 165617 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSB3K3
-
Backbone manufactureriGEM
- Backbone size w/o insert (bp) 2750
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namephzABCDEFG
-
SpeciesPseudomonas aeruginosa
-
Insert Size (bp)6289
- Promoter J23101
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TGCCACCTGACGTCTAAGAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSB3K3-101-phzAG was a gift from Martin Buck (Addgene plasmid # 165617 ; http://n2t.net/addgene:165617 ; RRID:Addgene_165617)