Skip to main content

pNSU299_YDR344C
(Plasmid #166072)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166072 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRS414
  • Backbone manufacturer
    Smith JD et al 2016. PMID 26956608
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Intergenic site near HXT6 (in YDR344C, possible dubious ORF)
  • gRNA/shRNA sequence
    TGAACATGTTGCAACAACTG
  • Species
    S. cerevisiae (budding yeast)
  • Promoter Tet-inducible

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Jim Haber/Neal Sugawara

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

gRNA Binding Coordinates: chrIV: 1162101-1162120 (+ strand) This is a yeast integration plasmid, and should be linearized with BstZ17I (or elsewhere within the TRP1 gene) before transformation for integration into Chromosome V of the yeast genome

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNSU299_YDR344C was a gift from Rebecca Burgess (Addgene plasmid # 166072 ; http://n2t.net/addgene:166072 ; RRID:Addgene_166072)