pNSU299_GAL2
(Plasmid
#166088)
-
PurposePlasmid for constituive spCas9 and tet-inducible GAL2 targeting sgRNA expression for double stranded break formation in yeast
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166088 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS414
-
Backbone manufacturerSmith JD et al 2016. PMID 26956608
-
Vector typeYeast Expression, CRISPR
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGAL2
-
gRNA/shRNA sequenceGATGGCTGGCTTTTACCGTG
-
SpeciesS. cerevisiae (budding yeast)
-
Entrez GeneGAL2
- Promoter Tet-inducible
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byJim Haber/Neal Sugawara
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA Binding Coordinates: chrXII:291472..291491 (- strand) This is a yeast integration plasmid, and should be linearized with BstZ17I (or elsewhere within the TRP1 gene) before transformation for integration into Chromosome V of the yeast genome
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNSU299_GAL2 was a gift from Rebecca Burgess (Addgene plasmid # 166088 ; http://n2t.net/addgene:166088 ; RRID:Addgene_166088)