Skip to main content

pMEL15_MATz
(Plasmid #166099)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166099 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    p426-SNR52p-gRNA.CAN1.Y-SUP4t, Daran Lab
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    clonNAT

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MAT Z1
  • gRNA/shRNA sequence
    CAGTAAAATTTTATAAACCC
  • Species
    S. cerevisiae (budding yeast)

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene QC identified differences to the theoretical sequence that the depositing lab does not believe are of functional concern.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMEL15_MATz was a gift from Rebecca Burgess (Addgene plasmid # 166099 ; http://n2t.net/addgene:166099 ; RRID:Addgene_166099)