pROS15_MATz
(Plasmid
#166100)
-
PurposeExpression of dual gRNA targeting the MAT locus
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166100 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep426-SNR52p-gRNA.CAN1.Y-SUP4t, Daran Lab
-
Vector typeYeast Expression, CRISPR
-
Selectable markersclonNAT
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMAT Z1
-
gRNA/shRNA sequencesgRNA1: ACTCTACAAAACCAAAACCA sgRNA 2: TATGCTGAAGTACGTGGTGA
-
SpeciesS. cerevisiae (budding yeast)
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pROS15_MATz was a gift from Rebecca Burgess (Addgene plasmid # 166100 ; http://n2t.net/addgene:166100 ; RRID:Addgene_166100)