Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pWZL N-Myc-hPOT1_K90E-IRES_hygro
(Plasmid #166407)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166407 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pWZL N-MYC
  • Backbone size w/o insert (bp) 5665
  • Total vector size (bp) 7561
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hPOT1
  • Alt name
    POT1
  • Alt name
    CMM10, GLM9, HPOT1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1896
  • Mutation
    K90E
  • Entrez Gene
    POT1 (a.k.a. CMM10, CRMCC3, GLM9, HPOT1, PFBMFT8, TPDS3)
  • Tag / Fusion Protein
    • myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer CCTTTGTACACCCTAAGCCT
  • 3′ sequencing primer AATGCTCGTCAAGAAGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWZL N-Myc-hPOT1_K90E-IRES_hygro was a gift from Agnel Sfeir (Addgene plasmid # 166407 ; http://n2t.net/addgene:166407 ; RRID:Addgene_166407)
  • For your References section:

    Replication stress conferred by POT1 dysfunction promotes telomere relocalization to the nuclear pore. Pinzaru AM, Kareh M, Lamm N, Lazzerini-Denchi E, Cesare AJ, Sfeir A. Genes Dev. 2020 Dec 1;34(23-24):1619-1636. doi: 10.1101/gad.337287.120. Epub 2020 Oct 29. 10.1101/gad.337287.120 PubMed 33122293