Skip to main content

pWZL N-Myc-hPOT1_deltaOB
(Plasmid #166408)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166408 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pWZL N-MYC
  • Backbone size w/o insert (bp) 5665
  • Total vector size (bp) 7189
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    POT1 ΔOB
  • Alt name
    POT1
  • Alt name
    CMM10, GLM9, HPOT1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1525
  • Mutation
    ΔOB
  • Entrez Gene
    POT1 (a.k.a. CMM10, CRMCC3, GLM9, HPOT1, PFBMFT8, TPDS3)
  • Tag / Fusion Protein
    • myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer CCTTTGTACACCCTAAGCCT
  • 3′ sequencing primer AATGCTCGTCAAGAAGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWZL N-Myc-hPOT1_deltaOB was a gift from Agnel Sfeir (Addgene plasmid # 166408 ; http://n2t.net/addgene:166408 ; RRID:Addgene_166408)
  • For your References section:

    Replication stress conferred by POT1 dysfunction promotes telomere relocalization to the nuclear pore. Pinzaru AM, Kareh M, Lamm N, Lazzerini-Denchi E, Cesare AJ, Sfeir A. Genes Dev. 2020 Dec 1;34(23-24):1619-1636. doi: 10.1101/gad.337287.120. Epub 2020 Oct 29. 10.1101/gad.337287.120 PubMed 33122293