pHAGE2-EF1a-MCS-dOB-hPOT1_IRES-blast
(Plasmid
#166413)
-
Purposeexpress hPOT1 ΔOB in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166413 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHAGE2-EF1a
- Backbone size w/o insert (bp) 8072
- Total vector size (bp) 9596
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameProtection Of Telomeres 1
-
Alt namePOT1
-
Alt nameCMM10, GLM9, HPOT1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1541
-
MutationΔOB deleted 125 a.a
-
GenBank IDNG_029232.1
-
Entrez GenePOT1 (a.k.a. CMM10, CRMCC3, GLM9, HPOT1, PFBMFT8, TPDS3)
- Promoter ef1-a
-
Tag
/ Fusion Protein
- myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NOT1 (unknown if destroyed)
- 3′ cloning site PAC1 (unknown if destroyed)
- 5′ sequencing primer GAACAAAAGTTGATTTCTGAAGAAGATTTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE2-EF1a-MCS-dOB-hPOT1_IRES-blast was a gift from Agnel Sfeir (Addgene plasmid # 166413 ; http://n2t.net/addgene:166413 ; RRID:Addgene_166413) -
For your References section:
Replication stress conferred by POT1 dysfunction promotes telomere relocalization to the nuclear pore. Pinzaru AM, Kareh M, Lamm N, Lazzerini-Denchi E, Cesare AJ, Sfeir A. Genes Dev. 2020 Dec 1;34(23-24):1619-1636. doi: 10.1101/gad.337287.120. Epub 2020 Oct 29. 10.1101/gad.337287.120 PubMed 33122293