pRK172-α-syn-TEV-GFP
(Plasmid #166671)

• Purpose: Bacterial expression of alpha synuclein coupled to GFP via a TEV site for uptake studies
• Depositing Lab: Iris Lindberg
• Publication: Jarvela et al PLoS One. 2021 Jan 26;16(1):e0241161. doi: 10.1371/journal.pone.0241161. eCollection 2021.

Backbone

• Vector backbone: pRK172
• Backbone manufacturer: Virginia Lee
• Modifications to backbone: A TEV site (ENLYFQG) was inserted following the 6x His tag, in frame with the start of the GFP sequence.
• Vector type: Bacterial Expression
• Selectable markers: none

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: While DH5alpha can be used for plasmid maintenance and storage, BL21(DE3) should be used for protein production. We used an autoinduction protocol.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: mouse synuclein (from V. Lee)
• Alt name: aSyn
• Species: M. musculus (mouse)
• Mutation: added a TEV cleavage site sequence between synuclein and GFP
• Entrez Gene: Snca (a.k.a. NACP, alpha-Syn, alphaSYN)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Dr. Virginia Lee, University of Pennsylvania
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The original plasmid reference is:
"Selective imaging of internalized proteopathic a-synuclein seeds in primary neurons reveals mechanistic insight into transmission of synucleinopathies" JBC 2017, DOI 0.1074/jbc.M117.780296
Richard J. Karpowicz, Jr. , Conor M. Haney , Tiberiu S. Mihaila , Raizel M. Sandler , E. James Petersson, and Virginia M.-Y. Lee