-
PurposeFor creating a stable mCherry-GAL9 cell line
-
Depositing Lab
-
Depositing OrganizationAstraZeneca (Sweden)
Located in Sweden -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166689 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 166689-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 166689-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneAAVS1 Donor Plasmid
- Backbone size w/o insert (bp) 4712
- Total vector size (bp) 6499
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLGALS9
-
Alt nameLGALS9A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1787
-
GenBank IDNM_009587
-
Entrez GeneLGALS9 (a.k.a. HUAT, LGALS9A)
- Promoter EF1a
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CCCCGTAATGCAGAAGAAGA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 166689-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 166689-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCherry-GAL9 was a gift from Alan Sabirsh (Addgene plasmid # 166689 ; http://n2t.net/addgene:166689 ; RRID:Addgene_166689) -
For your References section:
A high-throughput Galectin-9 imaging assay for quantifying nanoparticle uptake, endosomal escape and functional RNA delivery. Munson MJ, O'Driscoll G, Silva AM, Lazaro-Ibanez E, Gallud A, Wilson JT, Collen A, Esbjorner EK, Sabirsh A. Commun Biol. 2021 Feb 16;4(1):211. doi: 10.1038/s42003-021-01728-8. 10.1038/s42003-021-01728-8 PubMed 33594247
