pAM-DCA-muGFP
(Plasmid
#166727)
-
PurposeAAV, encodes monomeric ultrastable GFP (muGFP)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166727 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAM-DCA
- Backbone size w/o insert (bp) 5405
- Total vector size (bp) 6116
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemuGFP
-
Alt namemonomeric ultrastable GFP
-
Speciessynthetic/engineered
-
Insert Size (bp)711
- Promoter Chicken Beta Actin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer cctacagctcctgggcaacg
- 3′ sequencing primer gccatacgggaagcaatagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAM-DCA-muGFP was a gift from Daniel Scott (Addgene plasmid # 166727 ; http://n2t.net/addgene:166727 ; RRID:Addgene_166727) -
For your References section:
A Novel Ultra-Stable, Monomeric Green Fluorescent Protein For Direct Volumetric Imaging of Whole Organs Using CLARITY. Scott DJ, Gunn NJ, Yong KJ, Wimmer VC, Veldhuis NA, Challis LM, Haidar M, Petrou S, Bathgate RAD, Griffin MDW. Sci Rep. 2018 Jan 12;8(1):667. doi: 10.1038/s41598-017-18045-y. 10.1038/s41598-017-18045-y PubMed 29330459