Skip to main content
Addgene

Venus-BimEL-4E-pEGFP-C1
(Plasmid #166742)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166742 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BimEL-4E
  • Alt name
    Bcl2 like protein 11 (BCL2L11), isoform BimEL
  • Species
    M. musculus (mouse)
  • Mutation
    4 hydrophobic residues in the BH3 region mutated to glutamic acid: I146E, L150E, I153E, F157E.
  • Entrez Gene
    Bcl2l11 (a.k.a. 1500006F24Rik, Bim, Bod, bcl2-L-11)
  • Promoter CMV
  • Tag / Fusion Protein
    • Venus (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer TGACGCAAATGGGCGGTAGG
  • 3′ sequencing primer TCGCCCTTTGACGTTGGAGTCCAC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    BimEL sequence aligns with Mus musculus BCL2-like 11 (apoptosis facilitator) (Bcl2l11), transcript variant X3, mRNA NCBI Reference Sequence: XM_006498616.4.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Transfection of this plasmid will express "VBimEL-4E" (Venus fused to the N-terminus of the BH3-only protein, BimEL-4E) in live cells. There is a 3 amino acid flexible linker between Venus and BimEL-4E proteins. BH3 region has hydrophobic positions H1-H4 mutated to glutamic acid (E), refered to as "BH3-4E" mutation, BH3 mutations: I146E, L150E, I153E, F157E. When compared with EYFP, Venus fluorophore contains the following mutations: F46L, F64L, M153T, V163A and S175G. This Venus protein contains an F224R mutation to make it monomeric.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Venus-BimEL-4E-pEGFP-C1 was a gift from David Andrews (Addgene plasmid # 166742 ; http://n2t.net/addgene:166742 ; RRID:Addgene_166742)
  • For your References section:

    Bim escapes displacement by BH3-mimetic anti-cancer drugs by double-bolt locking both Bcl-XL and Bcl-2. Liu Q, Osterlund EJ, Chi X, Pogmore J, Leber B, Andrews DW. Elife. 2019 Mar 12;8. pii: 37689. doi: 10.7554/eLife.37689. 10.7554/eLife.37689 PubMed 30860026