Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Venus-Bad-2A-pEGFP-C1
(Plasmid #166748)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166748 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-C1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Bad-2A
  • Alt name
    Bcl2 associated agonist of cell death, or Bcl2 like protein 8 (BCL2L8)
  • Species
    H. sapiens (human)
  • Mutation
    2 hydrophobic residues in the BH3 region mutated to alanine: L114A, F121A
  • Entrez Gene
    BAD (a.k.a. BBC2, BCL2L8)
  • Promoter CMV
  • Tag / Fusion Protein
    • Venus (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer TGACGCAAATGGGCGGTAGG
  • 3′ sequencing primer TCGCCCTTTGACGTTGGAGTCCAC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Bad sequence aligns with Homo sapiens BAD mRNA for BCL2-antagonist of cell death protein (GenBank accession #: AB451254.1)
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Transfection of this plasmid will express "VBad-2A" (Venus fused to the N-terminus of the BH3-only protein, Bad-2A) in live cells. There is a flexible, 7 amino acid linker between Venus and Bad-2A proteins. BH3 region of Bad has hydrophobic positions H2 & H4 mutated to alanine (A), refered to as a "2A mutation", Mutations: L114A, F121A. When compared with EYFP, Venus fluorophore contains the following mutations: F46L, F64L, M153T, V163A and S175G. This Venus protein contains an F224R mutation to make it monomeric.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Venus-Bad-2A-pEGFP-C1 was a gift from David Andrews (Addgene plasmid # 166748 ; http://n2t.net/addgene:166748 ; RRID:Addgene_166748)
  • For your References section:

    Bim escapes displacement by BH3-mimetic anti-cancer drugs by double-bolt locking both Bcl-XL and Bcl-2. Liu Q, Osterlund EJ, Chi X, Pogmore J, Leber B, Andrews DW. Elife. 2019 Mar 12;8. pii: 37689. doi: 10.7554/eLife.37689. 10.7554/eLife.37689 PubMed 30860026