Venus-BimEL(Bad)-pEGFP-C1
(Plasmid
#166758)
-
PurposeTo examine effect of swapping the BH3 region in full length BimEL with that of Bad
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166758 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBimEL(Mus musculus)-(Bad BH3)
-
Alt nameBimEL-Bad, BimEL(Bad BH3), VBimEL(Bad), VBimEL(Bad BH3)
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
MutationBH3 region removed and inserted BH3 of human Bad protein
-
Entrez GeneBcl2l11 (a.k.a. 1500006F24Rik, Bim, Bod, bcl2-L-11)
-
Entrez GeneBAD (a.k.a. BBC2, BCL2L8)
- Promoter CMV
-
Tag
/ Fusion Protein
- Venus (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TGACGCAAATGGGCGGTAGG
- 3′ sequencing primer TCGCCCTTTGACGTTGGAGTCCAC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
BH3 region removed and inserted BH3 of Bad protein. Linker between Venus and BimEL(Bad) is 3 amino acids in length.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Venus-BimEL(Bad)-pEGFP-C1 was a gift from David Andrews (Addgene plasmid # 166758 ; http://n2t.net/addgene:166758 ; RRID:Addgene_166758) -
For your References section:
Bim escapes displacement by BH3-mimetic anti-cancer drugs by double-bolt locking both Bcl-XL and Bcl-2. Liu Q, Osterlund EJ, Chi X, Pogmore J, Leber B, Andrews DW. Elife. 2019 Mar 12;8. pii: 37689. doi: 10.7554/eLife.37689. 10.7554/eLife.37689 PubMed 30860026