Skip to main content

Venus-BimEL(Bad)-pEGFP-C1
(Plasmid #166758)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166758 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BimEL(Mus musculus)-(Bad BH3)
  • Alt name
    BimEL-Bad, BimEL(Bad BH3), VBimEL(Bad), VBimEL(Bad BH3)
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Mutation
    BH3 region removed and inserted BH3 of human Bad protein
  • Entrez Gene
    Bcl2l11 (a.k.a. 1500006F24Rik, Bim, Bod, bcl2-L-11)
  • Entrez Gene
    BAD (a.k.a. BBC2, BCL2L8)
  • Promoter CMV
  • Tag / Fusion Protein
    • Venus (N terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TGACGCAAATGGGCGGTAGG
  • 3′ sequencing primer TCGCCCTTTGACGTTGGAGTCCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

BH3 region removed and inserted BH3 of Bad protein. Linker between Venus and BimEL(Bad) is 3 amino acids in length.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Venus-BimEL(Bad)-pEGFP-C1 was a gift from David Andrews (Addgene plasmid # 166758 ; http://n2t.net/addgene:166758 ; RRID:Addgene_166758)
  • For your References section:

    Bim escapes displacement by BH3-mimetic anti-cancer drugs by double-bolt locking both Bcl-XL and Bcl-2. Liu Q, Osterlund EJ, Chi X, Pogmore J, Leber B, Andrews DW. Elife. 2019 Mar 12;8. pii: 37689. doi: 10.7554/eLife.37689. 10.7554/eLife.37689 PubMed 30860026