pLenti-TRE-FH-TET3 short
(Plasmid #166916)

• Purpose: Lentivirus for inducible overexpression of human TET3 short isoform lacking CXXC domain (NM_001366022.1)
• Depositing Lab: Roland Friedel
• Publication: Halawani et al Nat Commun. 2023 Aug 24;14(1):5165. doi: 10.1038/s41467-023-40816-7.

Backbone

• Vector backbone: pLenti CMVtight Neo DEST (w770-1) addgene 26432
• Backbone size w/o insert (bp): 10000
• Total vector size (bp): 13138
• Modifications to backbone: First, full length TET3 (PCR-ed from addgene plasmid 49446) was inserted using Gateway cloning. Second, a SalI - FseI fragment (synthesized as gBlock, IDT) was inserted into the SalI FseI sites to create the 5’ changes unique to TET3 short.
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TET3 short isoform
• Species: H. sapiens (human)
• Insert Size (bp): 5175
• Mutation: Changed nucleotide 18 (G) to (A) to delete FseI restriction site. This mutation does not affect the amino acid identity.
• GenBank ID: NM_001366022.1
• Tag / Fusion Protein:
  • HA Tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: FseI (not destroyed)
• 5′ sequencing primer: CMV Forward: CGCAAATGGGCGGTAGGCGTG

Resource Information

• Supplemental Documents:
  • pLenti-TRE-FH-TET3 D+E (short isoform).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry