pLenti-TRE-FH-TET3 short
(Plasmid
#166916)
-
PurposeLentivirus for inducible overexpression of human TET3 short isoform lacking CXXC domain (NM_001366022.1)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166916 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti CMVtight Neo DEST (w770-1) addgene 26432
- Backbone size w/o insert (bp) 10000
- Total vector size (bp) 13138
-
Modifications to backboneFirst, full length TET3 (PCR-ed from addgene plasmid 49446) was inserted using Gateway cloning. Second, a SalI - FseI fragment (synthesized as gBlock, IDT) was inserted into the SalI FseI sites to create the 5’ changes unique to TET3 short.
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTET3 short isoform
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5175
-
MutationChanged nucleotide 18 (G) to (A) to delete FseI restriction site. This mutation does not affect the amino acid identity.
-
GenBank IDNM_001366022.1
-
Tag
/ Fusion Protein
- HA Tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site FseI (not destroyed)
- 5′ sequencing primer CMV Forward: CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-TRE-FH-TET3 short was a gift from Roland Friedel (Addgene plasmid # 166916 ; http://n2t.net/addgene:166916 ; RRID:Addgene_166916) -
For your References section:
Circadian clock regulator Bmal1 gates axon regeneration via Tet3 epigenetics in mouse sensory neurons. Halawani D, Wang Y, Ramakrishnan A, Estill M, He X, Shen L, Friedel RH, Zou H. Nat Commun. 2023 Aug 24;14(1):5165. doi: 10.1038/s41467-023-40816-7. 10.1038/s41467-023-40816-7 PubMed 37620297