pTJV1ScGm-rpoB
(Plasmid
#166979)
-
PurposeGenerates ssDNA in vivo targeting E. coli rpoB for recombineering w/ Beta recombinase; temp. sensitive pSC101 ori and sgRNA for Cas9 counterselection; aacC1 for gentamycin resistance
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166979 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTJV1Sc-rpoB
- Total vector size (bp) 5966
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namegentamycin-3-acetyltransferase
-
Insert Size (bp)1067
-
Entrez Geneaac(3)-Ia (a.k.a. p165897_092)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggcggatcttcacctagatc
- 3′ sequencing primer gagacgttgatcggcacg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Same as pTJV1Sc-rpoB, but spectinomycin resistance marker changed to gentamycin resistance
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTJV1ScGm-rpoB was a gift from Christopher Reisch (Addgene plasmid # 166979 ; http://n2t.net/addgene:166979 ; RRID:Addgene_166979) -
For your References section:
Efficient and iterative retron-mediated in vivo recombineering in Escherichia coli. Ellington AJ, Reisch CR. Synth Biol (Oxf). 2022 May 3;7(1):ysac007. doi: 10.1093/synbio/ysac007. eCollection 2022. 10.1093/synbio/ysac007 PubMed 35673614