Lenti_CRISPRi_sgNeg1
(Plasmid
#166998)
-
PurposeLentiviral expression of negative control sgRNA for CRISPRi knockdown
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166998 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneLentiGuide_Hygro-eGFP
-
Backbone manufacturerAddgene #99375
- Backbone size w/o insert (bp) 9524
-
Vector typeLentiviral, CRISPR
-
Selectable markersHygromycin ; EGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNegative control sgRNA 1
-
gRNA/shRNA sequenceGCGCCAAACGTGCCCTGACGG
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Ligation Independent Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti_CRISPRi_sgNeg1 was a gift from Gian-Paolo Dotto (Addgene plasmid # 166998 ; http://n2t.net/addgene:166998 ; RRID:Addgene_166998) -
For your References section:
Sustained androgen receptor signaling is a determinant of melanoma cell growth potential and tumorigenesis. Ma M, Ghosh S, Tavernari D, Katarkar A, Clocchiatti A, Mazzeo L, Samarkina A, Epiney J, Yu YR, Ho PC, Levesque MP, Ozdemir BC, Ciriello G, Dummer R, Dotto GP. J Exp Med. 2021 Feb 1;218(2). pii: 211509. doi: 10.1084/jem.20201137. 10.1084/jem.20201137 PubMed 33112375